Bioinformatics/Global alignment: Difference between revisions
m
no edit summary
No edit summary |
mNo edit summary |
||
Line 4:
sequences appear in the same order and orientation, fitting the sequences in as pieces in a puzzle.
Current DNA sequencers find the sequence for multiple small segments of DNA which have mostly randomly formed by splitting a much larger DNA molecule into shorter segments. When re-assembling such segments of DNA sequences into a larger sequence to form, for example, the DNA coding for the relevant gene, the overlaps between multiple shorter sequences are commonly used to decide how the longer sequence is to be assembled. For example, "AAGATGGA", GGAGCGCATC", and "ATCGCAATAAGGA" can be assembled into the sequence "AAGATGGAGCGCATCGCAATAAGGA" by noting that "GGA" is at the tail of the first string and head of the second string and "ATC" likewise is at the tail
of the second and head of the third string.
| |||