Anonymous user
Bioinformatics/base count: Difference between revisions
m
added whitespace before the table of contents (TOC).
(Add Factor) |
m (added whitespace before the table of contents (TOC).) |
||
Line 13:
GACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT</pre>
# "Pretty print" the sequence followed by a summary of the counts of each of the bases, (A, C, G, and T) in the sequence as well as the total count of bases in the string.
<br><br>
=={{header|Factor}}==
| |||